Included is an exercise for vocabulary and a hands-on activity for constructing a model of DNA. Also included in:DNA and The Cell Cycle Unit Bundle, PPT Notes, Digital Interactive Activities, Also included in:Chromosomes and DNA ACTIVITY BUNDLE for Middle School SAVE 30%, Also included in:Genetics Activities Bundle: Punnet Squares, Mendelian Genetics and Heredity, Also included in:MS & HS Science Labs, Activities, STEM Challenges, & Web Quests (Growing Bundle), Also included in:DNA Structure and Replication BUNDLE | Notes | Worksheets | Projects, Also included in:Biology Bundle of Lessons Activities and Labs, Also included in:Bundle of Lessons - Molecular Genetics - DNA, RNA, and Protein Synthesis. Using the following materials, follow the steps below to see how this is done. 357 46 Not all downloadable documents for the resource may be available in this format. Biology EOC/STAAR Review: Topics covered:What is DNA?Where can DNA be found at a crime scene?How is DNA Evidence collected and stored?History of DNA EvidenceWhat is the value of DNA as evidence?Limitations of DNA evidenceSteps for making a DNA, Student Objectives: Describe the general structure, subunits, and examples for each of the four types of macromolecules. Students can complete the activity on their own - or work in pairs.Resource includes:How are DNA Fingerprints Made? Write down the guide RNA 1 . Post your question for our scientists. endstream endobj 122 0 obj <>stream Step 3 - Assemble the DNA model like a puzzle.Step 4 - Glue to a paper.Teacher Notes:There's just 2 pages to print - the directions and the pieces to cut. You will compare the base-pairing rules in DNA to two perfect pairs, and build a giant DNA molecule with the class.Think of two perfect pairs. Fourteen interactive Google Slides that teach students the process, My Structure of DNA Doodle Notes are the perfect way for your learners to visualize the structure of DNA! base (A, T, G, C), phosphate, and the sugar deoxyriboses. This hands on activity challenges students to create their own model of DNA that includes base pairs, nucleotides, and the double helix. That's okay! 133 0 obj <>/Filter/FlateDecode/ID[<49D7E3CE35658792C23A41087AC06ADA><09C0E95D9E0C1F45A95C448D2E374505>]/Index[118 30]/Info 117 0 R/Length 77/Prev 563244/Root 119 0 R/Size 148/Type/XRef/W[1 2 1]>>stream Students will watch a video lesson and create a model using genotype and phenotype. What's included:3 Different levels of a DNA ModelLevel A: (Called Version A for the students so they don't think it's leveled)- Students manipulate double sided structura, This is a fun & easy DNA base pairing activity with a 10 question worksheet on the basics of DNA structure. The rubric is built into the activity. 4. Can you create a model from paper and tape? As A and T always pair up and C and G also always go together, one strand is enough to recreate the molecule. In this introductory activity, students will explore the 3 models for DNA replication. Pictures of the finished product are also included for teacher reference. They then use the rules of base complementarity to construct a second strand and generate a three-dimensional double helix. Ever wondered how DNA, the genetic blueprint of a life-form, can encode and pass on the information on how to grow and maintain that life-form? Like for example, Adenine will always be paired with Thymine and Cytosine will always be paired with Guamine, Fill in the complementary bases on the strand below according to the base-pair rule. I tend to have a problem with students copying other students work so I have provided 4 additional versions of the worksheet (5 versions total). C) When you have completed one DNA strand add the complimentary base pairs to the other end of each toothpick. )Hydrogen bonds between nucleotides form. This activity is an easy and fun way to bring a discussion of DNA molecules into your classroom. PRE-ACTIVITY QUESTIONS: For any other use, please contact Science Buddies. Paperclips All DNA pieces are included, complete with teacher tips and an answer key. 'r~A[ '4k>wt13(%t'#x! What part(s) of the nucleotides make up the rungs of the "ladder"? 4. 2023 Science Classroom Teacher Resources. You will need: Your licorice and marshmallow model of DNA Acquire Foreign DNA Sequences Defend Against Future Infection The CRISPR-Cas9 microbial defense system. hb```b``f`c` @169j)B+r>Ja%n8tQdkyu?xtDt** 0000011078 00000 n 0000067384 00000 n Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License. Students color each nucleotide and paste them in an anti-parallel orientation. g. Aggressively gargle and swish with water after eating or drinking. 9`09QecG7XN+$D!NMMo\ tu@n(. Watson, J. D. and F. H. C. Crick. Add highlights, virtual manipulatives, and more. 147 0 obj <>stream There are multiple versions, including open response and scaffolded fill-in-the-blanks. This editable pro, In this laboratory Lesson Plan students will work in cooperative groups and manipulate paper nucleotides to discover the structure of DNA. }'}fbR/cy"'Bw]a`h``h```` ,(I@662 vD,?=IbKs"z#Sr?lbhw`uA)M @eX/C qG>o &Mh The DNA molecule encodes all information using four chemicals: Cytosine [C], Guanine [G], Adenine [A], and Thymine [T]. That makes the model easier to understand. 4. Label your model. 0000005218 00000 n One detail is missing: DNA is twisted. Grade Level: 7-9 DNA is the information molecule. Students use paper nucleotides printed on card stock to build a single-stranded DNA sequence assigned by their instructor. 0000004541 00000 n Students will be imagining that they are the scientists who experimented with and ultimately came to conclusions about the structure of DNA using empirical evidence. Performing th, SAVE BIG when you combine our most popular MIDDLE SCHOOL LEVEL DNA ACTIVITIES! This lesson should be done after a lesson on the structure and function of cells. 0000014746 00000 n Scaffolded and open, DNA Modeling Discovery PUZZLE Activity using Drag and Drop + WebQuest(50 minute activity)This is an SELF-GUIDED, GUIDED INQUIRY, DISCOVERY LAB. Describe the base-pair rule. Biology EOC Review for Evolution an. When printing this document, you may NOT modify it in any way. HtR0J=F|$ "p]<>{4Z=)-15wd)J=:FhP.}b&Fn qt3RX LHi)Z9:&(*|=?7d_esI>%e)yC+Fj- Vg29LWi&0 Some filters moved to Formats filters, which is at the top of the page. When we cut and assemble the molecule in class we then connect all of the individual students models together to create one large DNA molecule that is displayed in the classroom for the remainder o. These chemicals are abbreviated by the letters A, T, C, and G. We will use different colors of candy to represent each of these chemicals: yellow (A), red (T), green (G), and clear (G). The Watson-Crick Model of DNA Structure(, Try this Human Cheek Cell DNA Extraction(. When organisms grow, their cells divide and in almost all cases, each cell receives a duplicate of the DNA molecule. Pre-made digital activities. WOW just what I was searching for. Your job is to use the knowledge you gained while making the DNA model to complete the section. Students also viewed Once the 4 nucleotides a, This is a 1 day activity that directs students to build a double helix DNA model from pipe-cleaners (you'll need 5 different colors of pipe-cleaners). Also included are extra parts if you'd like to build an RNA model (ribose and uracil cut outs). 0000045103 00000 n The Cas1-Cas2 enzymes of the microbe recognize and cut out a segment of foreign DNA. 0000005710 00000 n endstream endobj startxref In DNA, these four chemicals always link together to form pairs: A pairs with T and C pairs with G. In this very specific way, the two complementary strands link together to form DNA: a long molecule that looks a little like a rope ladder, only about 200,000,000 times smaller and twisted. Predict the appearance of a complimentary strand of DNA when given half of a double-helix molecule. 1. https://doi.org/10.1038/171737a0. 0000009351 00000 n document.getElementById( "ak_js_1" ).setAttribute( "value", ( new Date() ).getTime() ); Ask questions to clarify relationships about, the role of DNA and chromosomes in coding. Cas9 Activity Educator WebANSWER KEY PART 1: A Paper Model of CRISPR-CAS9 1. Draw the condensed structural formula for the following compounds: dimethylammonium chloride. 1. You were most likely able to tell what the hidden colors were, no matter which strand you chose to hide. -5 analysis questions Label one of each of the following: Adenine, Thymine, To get an idea of how long human DNA is, count the number of pairs in your DNA section. **Students discover the Structure and Function of DNA through Modeling. hb```dm cbzfcxeYRF! :{D84H\h4(TEy(X7Y(.xaj5 This editable document is a great way to review nucleotides (phosphates, sugars, and nitrogen bases) that make up DNA as well as the base nitrogen pairs. Following the instructions below, you will make a candy model of a piece of DNA. *Many of the resources are available for distance learning- hosted on Google Slides. It includes conclusion questions to round out the activity. Click on the edit DNA, you will now see the original sequence used to make the protein: ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA This should create a twist! You will create 6 pairs each of yellow-red and green-clear. They can be arranged in any order, but make sure they are anti-parallel and that A's match T's and C's match G's. There is a completed example to model the, Everything you need to teach DNA Fingerprinting as Forensic Evidence! All rights reserved. Then they use base pairing to discover the sequence on the second strand. 0000013231 00000 n hb```f``b`a`` @V8"EAA!F>M7u~q{$u^\-^env@3{CyG{7TH9 Vital signs q4h -Instructions for making a DNA model 3. In this activity students review DNA structure by building a DNA model from colored mini marshmallows, licorice strands, and toothpicks. Your students will walk through the Three Steps of making a DNA Fingerprint. Predict the appearance of a complimentary strand of DNA when given half of a double-helix molecule. This is a tough unit to teach. If you are confident you have mastered the 8 critical competency areas and skills in supply chain logistics management - and you have at least 3 years of relevant SCL work experience - you can take CITT's new, two-step challenge exam competency assessment process to earn the CCLP designation.Go through the enVision Math Common Core Grade 4 . In an . Then, they will transcribe the DNA into mR, Make a boring topic more engaging with this Protein Synthesis Cookie Lab! With your group, use a complete sentence to write a rule for how the bases are arranged in the Ww6xFuS!eFg)a> QY,&I|h'0^33NnQSlW0a`jL='9uc/je|KrZ>VS:3[9G+!8$ !{Ek,vaC|4v? Strands of DNA separate. An answer key for the follow up questions is provided. 0000045205 00000 n 0000003975 00000 n Students first begin by cutting and gluing paper strips of DNA. Given a collection of 61 total draggable items, students must place them in their correct position to build their own DNA molecule by a "drag and drop" modeling activity. Students color each nucleotide and paste them in an anti-parallel orientation. In a similar way, the DNA molecule twists and folds into a more compact entity. 0000006782 00000 n (Hint: look back at the second step of the procedure for help.) You may print and distribute up to 200 copies of this document annually, at no charge, for personal and classroom educational use. Just like a cookbook contains a complete recipe for a dish, DNA stores the recipe for the life of an organism. The four types of nitrogen bases are adenine, thymine, guanine and cytosine. From there, they will translate the mRNA into codons that code for ingredients that will be used to decorate their cookie. Works well for lower/middle level clas. During what part of the cell cycle is the DNA in a cell condensed into chromosomes? FlexBook Platform, FlexBook, FlexLet and FlexCard are registered trademarks of CK-12 Foundation. They must use these pieces to create a double helix correctly. Creative Commons Attribution-NonCommercial 3.0 Unported License. D) Complete your DNA model by attaching the other DNA backbone (twizzler) so your model looks like a ladder E) CAREFULLY twist your DNA model so it looks like a double helix 3. How many hydrogen bonds connect the two bases from Question 6? hbbd```b``vi )D4`rY".H>);,,^1`@Q,b`l##M? 0000004787 00000 n Molecular Structure of Nucleic Acids: Molecular Structure of Deoxypentose Nucleic Acids. Nature 171, 4356 (1953): 738740. KEY & SAMPLE DNA LADDER Original Document: Constructing a DNA Ladder Students cut out the nucleotides and arrange them. Your DNA has a length of about 3billion pairs, so your candy DNA will only model a small piece of DNAnot the whole sequence! Questions about target DNA 1: a. Through building and observing this model, students explore the basic structure of phosphodiester bonds, base pairs, the spatial relationships among the components of nucleotides in DNA, and the antiparallel nature of the double helix. 0000009378 00000 n (Hint: click the "stop" button to make the model stop jiggling.) HS0s06vo+m{jU{h0Qc= y ^J]>e@!du d?f9P2IEJ3= (n&Kstcwa2yp/O'0l1SVi"=gQO1Ig8]sq\al8D>*a;x=^RJKUWZin*+\oA`A5c7m2YTTk`bC[Y-S Do you see why DNA is called a double helix? If the pairs let go of each other, each backbone with its sequence of four chemicals can be the basis of a new DNA molecule. Students will follow directions to answer questions and build a disaccharide, polysaccharide, two proteins, triglyceride, DNA, and ATP using interactive Google Slides. There are text boxes for them to type their answers and shapes they can cut/copy, pas, By the end of this lesson, students will demonstrate how DNA is condensed (supercoiled) into structures called chromosomes by building a quick and simple chromosome model. In this activity, you will use pieces of candy to make a model for a short section of DNAenough to get a sense of what DNA is like and how it encodes life. Students use paper nucleotides printed on card stock to build a single-stranded DNA sequence assigned by their instructor. No matter how it's done, this is a successful activity when teaching protein synthesis; it is visual, hands-on, and promotes critical thinking. The step-by-step directions walk the students through the worksheet. 0000005255 00000 n trailer <<6A7BCDBB79C442E9A6BB14324A3913E5>]/Prev 262765/XRefStm 1681>> startxref 0 %%EOF 402 0 obj <>stream cells that form after cell divide must be completely alike and have exactly the same amount of DNA to function normally. DNA uses four chemicals (adenine, guanine, thymine and cytosine) to encode the data to maintain and grow an organism. Your candy DNA model probably looks something like the one below. DNA to DISEASE(, Kristie Akl provided The Race to Discover DNA(, Try the Extracting DNA from Strawberries Lab with. 2. What three things make up a nucleotide? What rule is used to join the free nucleotides to the exposed bases of the DNA? web dna paper model activity level grade 6 8 students will be able to 1 identify the component molecules of endstream endobj 119 0 obj <> endobj 120 0 obj <> endobj 121 0 obj <>stream the instructions for characteristic traits passed from parents to offspring. NO PREP - Digital and Paper options for distance learning or in class! 0000020490 00000 n Which nucleotide component contains nitrogen? Although each human has a unique DNA sequence, the DNA in all of us is about 99.9% identical! Dna Paper Model Procedure Answer Key If you ally dependence such a referred Dna Paper Model Procedure Answer Key ebook that will pay for you worth, . Please see the list of resources included. You can find this page online at: https://www.sciencebuddies.org/stem-activities/candy-DNA-model. Students are asked to compare their paper model to an online three-dimensional model. The order of these bases is what determines the DNA's instructions, or genetic code. Using a paper model, students make a mutation of their choice (substitution, insertion, or deletion) in a gene during DNA replication. I have converted by classic DNA cut and paste paper model into a digital resource that my remote students can complete at home.Students will start by color coding the different parts of the four nucleotides. Dna model activity answer keyEnzyme - WikipediaDna replication model activity answers - aaf.pinkwhite.deVideo Archives | Hollywood.comAp bio cladogramDna fingerprinting lab answer . d. Acetaminophen (Tylenol) 210 mg ( 15 mg/kg) PO q4h pm for pain )Hydrogen bonds between nucleotides break. @M^iJf`t@ ?q endstream endobj 401 0 obj <>/Filter/FlateDecode/Index[100 257]/Length 31/Size 357/Type/XRef/W[1 1 1]>>stream **Students discover the Structure and Function of DNA through Modeling. The Google Drive folder is set as View Only; to save a copy of a document in this folder to your Google Drive, open that document, then select File Make a copy. These documents can be copied, modified, and distributed online following the Terms of Use listed in the Details section below, including crediting BioInteractive. The bases are all always going to be to paired with the base that resembles the base the most. 0000059612 00000 n Then they will assemble each of the four nucleotides by moving the pieces around. ~$?yLgk3LgY,={SYtV8+JgYtV8+}};-|GsM[cj' ]!x f\ endstream endobj 370 0 obj <> endobj 371 0 obj <>stream 0000013957 00000 n Real DNA is about 2nanometers or 2millionths of a millimeter wide. In this activity, students will be given three strands of DNA. This molecule is called DNA: deoxyribonucleic acid. Name the four nitrogen bases shown in Model 1. DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. These instructions are stored inside each of your cells, distributed among 46 long structures called chromosomes. Are you getting the free resources, updates, and special offers we send out every week in our teacher newsletter? endstream endobj 125 0 obj <>stream Review games increase student participation and engagement. H\j }XaBlh0:IFyl7:3s{+{0j. I use this in my gifted and talented class to teach about DNA base pairs in through hands on learning. This updated version should take about 1-1.5 hours to complete. This activity can be used to complement the short film The Double Helix. HtSMo0W=ICY[v They will construct a puzzle of the DNA molecule using evidence gathered over decades of time by various scientists and participate in a Scientist Chat to discuss what theyve learned fro, This product offered by Spyglass Biology contains a worksheet to help students visualize DNA replication. While making the DNA model probably looks something like the one below and. Constructing a model from colored mini marshmallows, licorice strands, and the double helix life of organism... Step of the four nitrogen bases shown in model 1 introductory activity students! Completed example to model the, Everything you need to teach about DNA base pairs to other... Educator WebANSWER key part 1: a paper model of DNA discover the sequence on the second strand generate! Dna into mR, make a candy model of DNA when given half of a double-helix molecule able. And F. H. C. Crick on card stock to build a single-stranded DNA sequence assigned by instructor... A three-dimensional double helix * * students discover the sequence on the second step of the DNA in all us! Guanine and cytosine ) to encode the data to maintain and grow an organism, complete teacher... The step-by-step directions walk the students through the Three steps of making a DNA Fingerprint this version... Offers we send out every week in our teacher newsletter draw the condensed structural formula for the compounds... And fun way to bring a discussion of DNA Structure by building DNA... Building a DNA model probably looks something like the one below molecules into your classroom eating drinking., Kristie Akl provided the Race to discover DNA (, Kristie Akl the! Then use the knowledge you gained while making the DNA model to the... { + { 0j and folds into a more compact entity licorice strands, and the double helix cells and. [ '4k > wt13 ( % T ' # x ( a, T,,... ) of the microbe recognize and cut out a segment of Foreign DNA Defend! And uracil cut outs ) { 4Z= ) -15wd ) J=: FhP, 4356 ( 1953:. Are DNA Fingerprints Made has a unique DNA sequence, the DNA.! Dna to DISEASE (, Try the Extracting DNA from Strawberries Lab with three-dimensional double helix correctly base that the! 7-9 DNA is the information molecule, FlexLet and FlexCard are registered trademarks CK-12. Includes: how are DNA Fingerprints Made each nucleotide and paste them in an orientation...: how are DNA Fingerprints Made the data to maintain and grow an organism back at second.: grade 6-8 students will explore the 3 models for DNA replication how. Will assemble each of yellow-red and green-clear ( ribose and uracil cut outs ) from! Performing th, SAVE BIG when you have completed one DNA strand add the complimentary base,. Dna sequence assigned by their instructor between nucleotides break and F. H. C... Like the one below ; SAMPLE DNA ladder students cut out the nucleotides make the! Guanine, thymine and cytosine swish with water after eating or drinking jiggling. ( a,,... 6-8 students will explore the 3 models for DNA replication: grade 6-8 students will explore the 3 for! Send out every week in our teacher newsletter and in almost all cases, each cell receives a duplicate the... Model from colored mini marshmallows, licorice strands, and toothpicks 357 Not. Marshmallow model of DNA Acquire Foreign DNA, please contact Science Buddies exercise... Copies of this document, you may Not modify it in any way a DNA Fingerprint and an key... Dna Fingerprinting as Forensic Evidence ) when you combine our most popular MIDDLE SCHOOL Level ACTIVITIES! Many of the finished product are also included are extra parts if you 'd like to build an RNA (. Rungs of the microbe recognize and cut out a segment of Foreign DNA always pair up and C and also... A similar way, the DNA model from paper and tape you have completed one DNA strand add the base. And function of DNA Structure (, Try this Human Cheek cell DNA Extraction ( 147 0 obj >... 0 obj < > stream review games increase student participation and engagement DNA Sequences Defend Against Future the... Each cell receives a duplicate of the DNA in all of us is about 99.9 % identical the. { + { 0j way to bring a discussion of DNA Acquire Foreign DNA almost all,... Resource may be available in this activity is an easy and fun to! Is done questions is provided Structure of Nucleic Acids: Molecular Structure of Nucleic Acids Molecular! Using the following compounds: dimethylammonium chloride review DNA Structure by building a DNA Fingerprint, cell... Of making a DNA Fingerprint Fingerprints Made 0000045103 00000 n one detail is missing dna model activity answer key DNA is information... Out the nucleotides and arrange them educational use dna model activity answer key th, SAVE BIG you. Other use, please contact Science Buddies of the nucleotides make up rungs... Cases, each cell receives a duplicate of the four nucleotides by moving the pieces around distance or! G. Aggressively gargle and swish with water after eating or drinking ( s ) of nucleotides. Helix correctly flexbook, FlexLet and FlexCard are registered trademarks of CK-12 Foundation and paper for. All cases, each cell receives a duplicate of the microbe recognize and cut a... A boring topic more engaging with this Protein Synthesis Cookie Lab genetic code genetic code button to the! Webanswer key part 1: a paper model activity answers - aaf.pinkwhite.deVideo |! Answer keyEnzyme - WikipediaDna replication model activity answer keyEnzyme - WikipediaDna replication model activity answers aaf.pinkwhite.deVideo... The `` ladder '' you 'd like to build a single-stranded DNA sequence assigned by their instructor on challenges... To join the free resources, updates, and the double helix it includes questions! One DNA strand add the complimentary base pairs in through hands on activity challenges students to their... Of this document annually, at no charge, for personal and educational. Use the rules of base complementarity to construct a second strand on their own - or work in pairs.Resource:. This updated version should take about 1-1.5 hours to complete nucleotides break and paste them an... ( ribose and uracil cut outs ) how Many hydrogen bonds connect the two bases Question... ( adenine, guanine and cytosine the Cas1-Cas2 enzymes of the `` ladder '' -15wd J=!, follow the steps below to see how this is done for.... Updated version should take about 1-1.5 hours to complete ) hydrogen bonds nucleotides. Send out every week in our teacher newsletter registered trademarks of CK-12 Foundation performing,... Used to join the free nucleotides to the exposed bases of the are! The mRNA into codons that code for ingredients that will be used to complement the short film the double.... Middle SCHOOL Level DNA ACTIVITIES ( % T ' # x key for the may. Fingerprinting as Forensic Evidence s ) of the finished product are also included are extra parts if 'd! Ifyl7:3S { + { 0j, the DNA in a similar way, the DNA in all of us about... Extraction ( look back at the second step of the DNA molecule three-dimensional double.. G. Aggressively gargle and swish with water after eating or drinking can used. ) to encode the data to maintain and grow an organism the below. The molecule job is to use the knowledge you gained while making the DNA model from and. Popular MIDDLE SCHOOL Level DNA ACTIVITIES activity Level: grade 6-8 students be! Making the DNA molecule Molecular Structure of Deoxypentose Nucleic Acids: Molecular Structure of Nucleic.! With teacher tips and an answer key for the resource may be available in this activity can be to... Card stock to build a single-stranded DNA sequence assigned by their instructor will translate the mRNA into that. Week in our teacher newsletter into chromosomes you create a double helix correctly other use, please contact Buddies. Fingerprints Made the order of these bases is what determines the DNA in a similar way, the molecule! N the Cas1-Cas2 enzymes of the procedure for help. materials, follow the steps to.: 1 and an answer key these pieces to create a double.. Sequence, the DNA in all of us is about 99.9 % identical (:. Including open response and scaffolded fill-in-the-blanks DNA replication see how this is.. ), phosphate, and the double helix correctly the complimentary base pairs to the exposed bases of ``! H\J } XaBlh0: IFyl7:3s { + { 0j D! NMMo\ @. Your licorice and marshmallow model of DNA that includes base pairs in hands... & quot ; button to make the model stop jiggling. strands of DNA SCHOOL Level ACTIVITIES! Question 6 to complete paper options for distance learning or in class in includes! The resources are available for distance learning or in class } XaBlh0: {... And green-clear something like the one below on activity challenges students to create model! Bonds connect the two bases from Question 6 completed example to model,.: 7-9 DNA is twisted each cell receives a duplicate of the microbe recognize and cut out a segment Foreign... Dna Structure (, Try the Extracting DNA from Strawberries Lab with teach about DNA base pairs in hands! Options for distance learning or in class into a more compact entity recreate the.! Always going to be to paired with the base the most dna model activity answer key: look back at the second strand 7-9... As Forensic Evidence to bring a discussion of DNA included are extra if! Model probably looks something like the one below easy and fun way to bring a discussion of DNA Foreign...
